Review



reverse primer  (tiangen biotech co)


Bioz Verified Symbol tiangen biotech co is a verified supplier
Bioz Manufacturer Symbol tiangen biotech co manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    tiangen biotech co reverse primer
    Reverse Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 362 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse primer/product/tiangen biotech co
    Average 99 stars, based on 362 article reviews
    reverse primer - by Bioz Stars, 2026-05
    99/100 stars

    Images



    Similar Products

    universal reverse pcr primer  (Servicebio Inc)
    86
    Servicebio Inc universal reverse pcr primer
    Universal Reverse Pcr Primer, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/universal reverse pcr primer/product/Servicebio Inc
    Average 86 stars, based on 1 article reviews
    universal reverse pcr primer - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    reverse primer  (tiangen biotech co)
    99
    tiangen biotech co reverse primer
    Reverse Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse primer/product/tiangen biotech co
    Average 99 stars, based on 1 article reviews
    reverse primer - by Bioz Stars, 2026-05
    99/100 stars
    		  Buy from Supplier
    primer  (tiangen biotech co)
    99
    tiangen biotech co primer
    Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer/product/tiangen biotech co
    Average 99 stars, based on 1 article reviews
    primer - by Bioz Stars, 2026-05
    99/100 stars
    		  Buy from Supplier
    primer chatcre common reverse cag ggt tag tag ggg gtc ac  (Jackson Laboratory)
    86
    Jackson Laboratory primer chatcre common reverse cag ggt tag tag ggg gtc ac
    Primer Chatcre Common Reverse Cag Ggt Tag Tag Ggg Gtc Ac, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer chatcre common reverse cag ggt tag tag ggg gtc ac/product/Jackson Laboratory
    Average 86 stars, based on 1 article reviews
    primer chatcre common reverse cag ggt tag tag ggg gtc ac - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac  (Sangon Biotech)
    86
    Sangon Biotech epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac
    Epcam Primers Forward Ttgccgcagctcaggaagaatg Reverse Gcagccagctttgagcaaatgac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac/product/Sangon Biotech
    Average 86 stars, based on 1 article reviews
    epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    primer smo l l mutant reverse ctc cag act gcc ttg gga aaa  (Jackson Laboratory)
    86
    Jackson Laboratory primer smo l l mutant reverse ctc cag act gcc ttg gga aaa
    Primer Smo L L Mutant Reverse Ctc Cag Act Gcc Ttg Gga Aaa, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer smo l l mutant reverse ctc cag act gcc ttg gga aaa/product/Jackson Laboratory
    Average 86 stars, based on 1 article reviews
    primer smo l l mutant reverse ctc cag act gcc ttg gga aaa - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    reverse primers  (Azenta)
    86
    Azenta reverse primers
    Reverse Primers, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reverse primers/product/Azenta
    Average 86 stars, based on 1 article reviews
    reverse primers - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag  (Sangon Biotech)
    86
    Sangon Biotech dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag
    Dyrk1b Primers Forward Cgcaggaggtcgtacaggtgg Reverse Accagcatgacacggagatgaag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag/product/Sangon Biotech
    Average 86 stars, based on 1 article reviews
    dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag  (Sangon Biotech)
    86
    Sangon Biotech wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag
    Wdr77 Primers Forward Cacttgtgttgctgcctctcctc Reverse Aagccagcgaggtaggaaggtag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag/product/Sangon Biotech
    Average 86 stars, based on 1 article reviews
    wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier
    actb primers forward actcttccagccttccttcc reverse tctccttctgcatcctgtcg  (Sangon Biotech)
    86
    Sangon Biotech actb primers forward actcttccagccttccttcc reverse tctccttctgcatcctgtcg
    Actb Primers Forward Actcttccagccttccttcc Reverse Tctccttctgcatcctgtcg, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/actb primers forward actcttccagccttccttcc reverse tctccttctgcatcctgtcg/product/Sangon Biotech
    Average 86 stars, based on 1 article reviews
    actb primers forward actcttccagccttccttcc reverse tctccttctgcatcctgtcg - by Bioz Stars, 2026-05
    86/100 stars
    		  Buy from Supplier

    Image Search Results